View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7590_low_18 (Length: 338)

Name: NF7590_low_18
Description: NF7590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7590_low_18
NF7590_low_18
[»] chr7 (1 HSPs)
chr7 (195-329)||(25107673-25107807)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 195 - 329
Target Start/End: Original strand, 25107673 - 25107807
Alignment:
195 tattgagaatctctttcatgaagaatctccaaccccacaggtgatggagcacatggtgatgtcgaagatatgtgcaaggacttatcatctctctcactaa 294  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
25107673 tattgagaatctctttcatgaagaatctccaaccccacaggtgatggagcacatggtgatgtcgaagatatgtgcaaggacttatcatctctctcactag 25107772  T
295 aattattagtcttttttaatacatatcaatatcat 329  Q
    ||||||| |||||||||||||||||||||||||||    
25107773 aattattggtcttttttaatacatatcaatatcat 25107807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University