View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7590_low_18 (Length: 338)
Name: NF7590_low_18
Description: NF7590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7590_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 195 - 329
Target Start/End: Original strand, 25107673 - 25107807
Alignment:
| Q |
195 |
tattgagaatctctttcatgaagaatctccaaccccacaggtgatggagcacatggtgatgtcgaagatatgtgcaaggacttatcatctctctcactaa |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25107673 |
tattgagaatctctttcatgaagaatctccaaccccacaggtgatggagcacatggtgatgtcgaagatatgtgcaaggacttatcatctctctcactag |
25107772 |
T |
 |
| Q |
295 |
aattattagtcttttttaatacatatcaatatcat |
329 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25107773 |
aattattggtcttttttaatacatatcaatatcat |
25107807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University