View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7590_low_23 (Length: 263)
Name: NF7590_low_23
Description: NF7590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7590_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 228
Target Start/End: Original strand, 3489192 - 3489405
Alignment:
| Q |
15 |
tcgtgttagtatggtgtctgatgtatgtagactacctgcttgatttgcttgatatggacctttttgttttacgagtgtctgttaaatcttagagatgctc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3489192 |
tcgtgttagtatggtgtctgatgtatgtcgactacctgcttgatttgcttgatatggacctttttgttttacgagtgtctgttaaatcttagagatgctc |
3489291 |
T |
|
| Q |
115 |
aattgaaacacctatacatgcagaaaatttgtttattagaagtgagaatgttgttcagtgaaatatatttttgattttgggtggctgaaattaaagaatg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3489292 |
aattgaaacacctatacatgcagaaaatttgtttattagaagtgagaatgttgctcagtgaaatatatttttgattttgggtggctgaaattaaagaatg |
3489391 |
T |
|
| Q |
215 |
aaggagcctcttag |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3489392 |
aaggagcctcttag |
3489405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University