View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7590_low_28 (Length: 240)
Name: NF7590_low_28
Description: NF7590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7590_low_28 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 44802619 - 44802841
Alignment:
| Q |
18 |
ggtttcagggttatccttacagtaatcctccaaggggtcagaatccttcttcctatcccttgcatgactcgctgcagcactgagttcctccacttcatcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802619 |
ggtttcagggttatccttacagtaatcctccaaggggtcagaatccttcttcctatcccttgcatgactcgctgcagcactgagttcctccacttcatcc |
44802718 |
T |
 |
| Q |
118 |
catgctgctacgcattctccactaactgggtcatcagcacacgtctcttgtgcactctttatgctctcttctaccttctttgatatctgttctggtgcag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44802719 |
catgctgctacgcattctccactaactgggtcatcagcacacgtctcttgtgcactctttatgctctcttcaaccttctttgatatctgttctggtgcag |
44802818 |
T |
 |
| Q |
218 |
cacgaacgggtcgaaccaccgtc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44802819 |
cacgaacgggtcgaaccaccgtc |
44802841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University