View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7591_high_2 (Length: 567)
Name: NF7591_high_2
Description: NF7591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7591_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 397 - 532
Target Start/End: Complemental strand, 7900259 - 7900125
Alignment:
| Q |
397 |
tatattgtatccatgattccactcaaaattgtctagaagagaccacacaaagtaccctctcacatctgctccttttctgtgcacaaaagtaacttgttta |
496 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
7900259 |
tataatgtattcatgattccactcaaaattgtctagaagagaccacacaaagtaccctctcacatctgcaccttttctgtgcacaaaa-taacttgttta |
7900161 |
T |
|
| Q |
497 |
tttttgtactacacaaaccaaaacagttgatgattg |
532 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7900160 |
tttttgtactacacaaaccaaaacagtagatgattg |
7900125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 396 - 491
Target Start/End: Complemental strand, 7892357 - 7892262
Alignment:
| Q |
396 |
ttatattgtatccatgattccactcaaaattgtctagaagagaccacacaaagtaccctctcacatctgctccttttctgtgcacaaaagtaactt |
491 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7892357 |
ttatactgtatccatgattccactcaaaattgtctagaatagaccacacaaagtaccctttcacatctgctccttttctgtacacaaaagtaactt |
7892262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University