View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7591_low_13 (Length: 296)
Name: NF7591_low_13
Description: NF7591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7591_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 11 - 262
Target Start/End: Complemental strand, 33546268 - 33546008
Alignment:
| Q |
11 |
agaatatatgttgagatgccggcttgttgatcgatctgatatgcaatcagctgttaatcaccccaacgtcttatcaaacaaaacaaatttaatttggtga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33546268 |
agaatatatgttgagatgccggcttgttgatcgatctgatatgcaatcagctgttaatcaccacaacgtcttatcaaacaaaacaaatttaatttggtga |
33546169 |
T |
 |
| Q |
111 |
atatttaagcatggttctttttgtcta---------ttttgtttctctaataatgtctttctagccatgagaaaatattattttcgtacaaatgtttgtt |
201 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33546168 |
atatttaagcatggttctttttgtctattttatttattttgtttctctaataatgtctttgtagccatgagaaaataatattttcgtacaaatgtttgtt |
33546069 |
T |
 |
| Q |
202 |
agttagtacctttaattattaataaattattgtcagatctgctcttttgcattatgatgga |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33546068 |
agttagtacctttaattattaataaattattgtcagatctgctcttttgcattatgatgga |
33546008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 54
Target Start/End: Complemental strand, 33556152 - 33556119
Alignment:
| Q |
21 |
ttgagatgccggcttgttgatcgatctgatatgc |
54 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
33556152 |
ttgagatgccggcttgtcgatcgatctgatatgc |
33556119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University