View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7591_low_18 (Length: 250)
Name: NF7591_low_18
Description: NF7591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7591_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 76 - 237
Target Start/End: Complemental strand, 850617 - 850456
Alignment:
| Q |
76 |
ggatttgtggtgcaccatgccagaaatgaaacaaagcagtcatagaatcaaatttaataatctcaacatgcgaaaaaccacggcctttagcacttgcaac |
175 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
850617 |
ggatttgtggtgcaccaagctagaaatgaaacaaagcagtcatagaatcaaatttaataatctcaatatgcaaaaaaccacggcctttagcacttgcaac |
850518 |
T |
 |
| Q |
176 |
ccaattataaatagcccaaagttcagccatagcgataatgcaacctggtaactataagagta |
237 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
850517 |
ccaattataaataggccaaagttcagccatagcgataatgcaacctggtaactgtaggagta |
850456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University