View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7591_low_18 (Length: 250)

Name: NF7591_low_18
Description: NF7591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7591_low_18
NF7591_low_18
[»] chr5 (1 HSPs)
chr5 (76-237)||(850456-850617)


Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 76 - 237
Target Start/End: Complemental strand, 850617 - 850456
Alignment:
76 ggatttgtggtgcaccatgccagaaatgaaacaaagcagtcatagaatcaaatttaataatctcaacatgcgaaaaaccacggcctttagcacttgcaac 175  Q
    ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||    
850617 ggatttgtggtgcaccaagctagaaatgaaacaaagcagtcatagaatcaaatttaataatctcaatatgcaaaaaaccacggcctttagcacttgcaac 850518  T
176 ccaattataaatagcccaaagttcagccatagcgataatgcaacctggtaactataagagta 237  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||    
850517 ccaattataaataggccaaagttcagccatagcgataatgcaacctggtaactgtaggagta 850456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University