View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7591_low_2 (Length: 567)

Name: NF7591_low_2
Description: NF7591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7591_low_2
NF7591_low_2
[»] chr2 (2 HSPs)
chr2 (397-532)||(7900125-7900259)
chr2 (396-491)||(7892262-7892357)


Alignment Details
Target: chr2 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 397 - 532
Target Start/End: Complemental strand, 7900259 - 7900125
Alignment:
397 tatattgtatccatgattccactcaaaattgtctagaagagaccacacaaagtaccctctcacatctgctccttttctgtgcacaaaagtaacttgttta 496  Q
    |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||    
7900259 tataatgtattcatgattccactcaaaattgtctagaagagaccacacaaagtaccctctcacatctgcaccttttctgtgcacaaaa-taacttgttta 7900161  T
497 tttttgtactacacaaaccaaaacagttgatgattg 532  Q
    ||||||||||||||||||||||||||| ||||||||    
7900160 tttttgtactacacaaaccaaaacagtagatgattg 7900125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 396 - 491
Target Start/End: Complemental strand, 7892357 - 7892262
Alignment:
396 ttatattgtatccatgattccactcaaaattgtctagaagagaccacacaaagtaccctctcacatctgctccttttctgtgcacaaaagtaactt 491  Q
    ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||    
7892357 ttatactgtatccatgattccactcaaaattgtctagaatagaccacacaaagtaccctttcacatctgctccttttctgtacacaaaagtaactt 7892262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University