View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7593_high_6 (Length: 240)
Name: NF7593_high_6
Description: NF7593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7593_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 226
Target Start/End: Original strand, 32272371 - 32272583
Alignment:
| Q |
14 |
ttggtgttattgtaagaagggagtggtggcatgattggttttgttttgattgaattgtggtattggagaatggctgtggttgtggtgttatcgaacggtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32272371 |
ttggtgttattgtaagaagggagtggtggcatgattggttttgttttgattgaattgtggtattggagaatggctgtggttgtggtgttatcgaacggtg |
32272470 |
T |
|
| Q |
114 |
cattttgggcggattgataggcgcgtgcagctatgtagtatttggaaggtggttggtttgcgtgtattaagacatcggtggtttggccgggtcctaacat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32272471 |
cattttgggcggattgataggcgcgtgcagctatgtagtatttggaaggtggttggtttgcgtgtattaagacatcggtggtttggccgggtcctaacat |
32272570 |
T |
|
| Q |
214 |
gaggatgttggtg |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32272571 |
gaggatgttggtg |
32272583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University