View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7594_low_4 (Length: 266)
Name: NF7594_low_4
Description: NF7594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7594_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 43023940 - 43024175
Alignment:
| Q |
16 |
atagtgtgaagagacaaatcccaatcaatactgctgtgccaagaaaacgatccatcagaggcgcaagttagtagagatcaacatcgcacttggtgggcac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43023940 |
atagtgtgaagagacaaatcccaatcaatactgctgtgccaagaaaacgatccatcagaggcgcaagttagtagagatcaacatcgcacttggtgggcac |
43024039 |
T |
 |
| Q |
116 |
aagctgagtggaggtattcttagaattcaaaggaactttgaggtcacatttcactttcggattgatacgaccaaatatcacattcccgagtctgaatcta |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43024040 |
aagctgagtgaaggtattcttagaattcaaaggaactttgaggtcacatttcactttcggattgatacgaccaaatatcacattcccgagtctgaatcta |
43024139 |
T |
 |
| Q |
216 |
atttcgaagtagagtttcacatagatatcataaact |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43024140 |
atttcgaagtagagtttcacatagatatcataaact |
43024175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University