View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7594_low_6 (Length: 248)
Name: NF7594_low_6
Description: NF7594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7594_low_6 |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 36594888 - 36595108
Alignment:
| Q |
7 |
ttctgatacaaggcttgaatcttgtaagattgtttctttattctaacaccatatatttgattatgattttcttctttcttattccacatattatggtttg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| || |||||||||||| |
|
|
| T |
36594888 |
ttctgatacaaggcttgaatcttgtaagattgtttctttattctaacaccagatatttgattatgattttcttctttcatattctacctattatggtttg |
36594987 |
T |
 |
| Q |
107 |
tttactttaaaaatcctgcaagattgtttccttattttgtgactaaatatttgattatgattttcttatttcttattccataatatttttatgtgagata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36594988 |
tttactttaaaaatcctgcaagattgtttccttattttgtgactaaatat----ttatgattttcttatttcttattccataatatttttatgtgagata |
36595083 |
T |
 |
| Q |
207 |
tgacatagtttcttatgaaatgaat |
231 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36595084 |
tgacatagtttcttatgaaatgaat |
36595108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 19440861 - 19440824
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19440861 |
atatatttgattaagattttcttcttccttattccaca |
19440824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 25448380 - 25448343
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25448380 |
atatatttgattaagattttcttcttccttattccaca |
25448343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 25452715 - 25452678
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25452715 |
atatatttgattaagattttcttcttccttattccaca |
25452678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 189
Target Start/End: Original strand, 19086390 - 19086457
Alignment:
| Q |
121 |
cctgcaagattgtttccttattttgtgactaaatatttgattatgattttcttatttcttattccataa |
189 |
Q |
| |
|
||||||| |||||||||||||| | ||| ||| ||||| ||||||||||||| ||||||||| ||||| |
|
|
| T |
19086390 |
cctgcaaaattgtttccttattctatgatcaaa-atttggttatgattttcttctttcttattgcataa |
19086457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 94
Target Start/End: Original strand, 23190764 - 23190799
Alignment:
| Q |
59 |
atatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23190764 |
atatttgattatgattttattctttcttattccaca |
23190799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 94
Target Start/End: Complemental strand, 25694662 - 25694627
Alignment:
| Q |
59 |
atatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25694662 |
atatttgattatgattttattctttcttattccaca |
25694627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 12662508 - 12662471
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
12662508 |
atatatttgattaagattttcttcttccttattccaca |
12662471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 30677022 - 30676985
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30677022 |
atatatttgattaagattttcttcttccttattccaca |
30676985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 93
Target Start/End: Complemental strand, 1911176 - 1911140
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccac |
93 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
1911176 |
atatatttgattaagattttcttcttccttattccac |
1911140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 30717537 - 30717500
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30717537 |
atatatttgattaagattttcttcttccttattccaca |
30717500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 30725255 - 30725218
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30725255 |
atatatttgattaagattttcttcttccttattccaca |
30725218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 21174510 - 21174473
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
21174510 |
atatatttgattaagattttcttcttccttattccaca |
21174473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 23056697 - 23056660
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
23056697 |
atatatttgattaagattttcttcttccttattccaca |
23056660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 93
Target Start/End: Complemental strand, 35267855 - 35267819
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccac |
93 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
35267855 |
atatatttgattaagattttcttcttccttattccac |
35267819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 15755824 - 15755787
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15755824 |
atatatttgattaagattttcttcttccttattccaca |
15755787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 49490052 - 49490015
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
49490052 |
atatatttgattaagattttcttcttccttattccaca |
49490015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Original strand, 11657073 - 11657110
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
11657073 |
atatatttgattaagattttcttcttccttattccaca |
11657110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 31096256 - 31096219
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccaca |
94 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
31096256 |
atatatttgattaagattttcttcttccttattccaca |
31096219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 93
Target Start/End: Original strand, 108712 - 108748
Alignment:
| Q |
57 |
atatatttgattatgattttcttctttcttattccac |
93 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
108712 |
atatatttgattaagattttcttcttccttattccac |
108748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University