View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7595_high_19 (Length: 371)
Name: NF7595_high_19
Description: NF7595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7595_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 7 - 207
Target Start/End: Complemental strand, 36130907 - 36130708
Alignment:
| Q |
7 |
gtttttggtttaaactttaaatgagttcattatcagttcttctctagggcaaaaaataaggagaagaattgcagcaaattatctatatggagaaaaatat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36130907 |
gtttttggtttaaactttaaatgagttc-ttatcagttcttctctagggcaaaaaataaggagaagaattgcagcaaattatctatatggagaaaaatat |
36130809 |
T |
 |
| Q |
107 |
ggaaaagaggaacaaatatgaagaagaggagttaattctccatcttaatggtgggatttatgcactgttcgagcatatagaaacttggatattgcctctt |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36130808 |
ggaaaagaggaacaaatatggagaagaggtgttaattctccatcttaacggtgggatttatgcactgttcgagcatatagaaacttggatattgcctctt |
36130709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 210 - 365
Target Start/End: Complemental strand, 36130649 - 36130494
Alignment:
| Q |
210 |
tagttttggatttgggaagctggatagatgactcttgcgtcttgaaatttgattagacaatgaacttttttgtttggggaaaacaaccaattctagagtt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36130649 |
tagttttggatttgggaagctggatagatgactcttgcgtcttgaaatttgattagacaatgaagttttttgtttgggaaaaacaaccaattctagagtt |
36130550 |
T |
 |
| Q |
310 |
caataactttctttcctttgtatctctatctctttctgatgatgcagtcaaatttg |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36130549 |
caataactttctttcctttgtatctctatctctttctgatgatgcagtcaaatttg |
36130494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University