View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7595_high_27 (Length: 256)
Name: NF7595_high_27
Description: NF7595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7595_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 32773404 - 32773632
Alignment:
| Q |
18 |
agacccaccggaaaacccgccggagtggagaaaaaggtcaccgtggaatcatcgtcatctacaaagccgaaagttaaagtgaagcctgctcatccgccgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32773404 |
agacccaccggaaaacccgccggagtggagaaaaaggtcaccgtggaatcatcttcatctacaaagccgaaagttaaagtgaagcctgctcatccgccgt |
32773503 |
T |
 |
| Q |
118 |
tgatgcagccgccgaggtcttcatgttgtttgccggtgaccggcgccggaatgtctatggcgactatgattgaacagaagttggtgggttgttcaaaatc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32773504 |
tgatgcagccgccgaggtcttcatgttgtttgccggtgaccggtgccggaatgtctatggcgactatgattgaacagaagttggtgggttgttcaaaatc |
32773603 |
T |
 |
| Q |
218 |
tcgtaatgggtatgagccgtttcttctca |
246 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
32773604 |
tcgtaatgggtatgagccgtttgttctca |
32773632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University