View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7595_high_29 (Length: 250)

Name: NF7595_high_29
Description: NF7595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7595_high_29
NF7595_high_29
[»] chr1 (1 HSPs)
chr1 (105-213)||(929421-929529)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 105 - 213
Target Start/End: Original strand, 929421 - 929529
Alignment:
105 tgaggggaccatgacctctgccagtccctttcattggtgagctttattaatggaagggagtagatccattaacaaaacatgagttgtaactagtgagaat 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
929421 tgaggggaccatgacctctgccagtccctttcattggtgagctttattaatggaagggagtagatccattaacaaaacatgagttgtaactagtgagaat 929520  T
205 ttaaccttt 213  Q
    |||||||||    
929521 ttaaccttt 929529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University