View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7595_high_29 (Length: 250)
Name: NF7595_high_29
Description: NF7595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7595_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 105 - 213
Target Start/End: Original strand, 929421 - 929529
Alignment:
| Q |
105 |
tgaggggaccatgacctctgccagtccctttcattggtgagctttattaatggaagggagtagatccattaacaaaacatgagttgtaactagtgagaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
929421 |
tgaggggaccatgacctctgccagtccctttcattggtgagctttattaatggaagggagtagatccattaacaaaacatgagttgtaactagtgagaat |
929520 |
T |
 |
| Q |
205 |
ttaaccttt |
213 |
Q |
| |
|
||||||||| |
|
|
| T |
929521 |
ttaaccttt |
929529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University