View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7595_high_7 (Length: 488)
Name: NF7595_high_7
Description: NF7595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7595_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 430; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 33 - 478
Target Start/End: Original strand, 56437566 - 56438011
Alignment:
| Q |
33 |
ttgcattgcactgcttgaattgttgcacaatccaaaattcagttttgacttgcaatagatgtatttatgtcgctgtgttgattagtagcaggtttttatg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56437566 |
ttgcattgcactgcttgaattgttgcacaatccaaaattcagttttgacttgcaatagatgtatttatgtcgctgtgttgattagtagcaggtttttatg |
56437665 |
T |
 |
| Q |
133 |
ttggcaggtgtggtttctaattcaaactggttcatgtgcattcaaaatagtgtgattgctgtctggcttagccgtattttggtgtataactaaggtttag |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
56437666 |
ttggcaggtgtggtttctaattcaaactggttcatgtgcattcaaaatagtgtgattgctgtctgacttagccgtattttggtgtataactaaggtttcg |
56437765 |
T |
 |
| Q |
233 |
catcaggtcgggtctccgcattctgtgggttgaagtctgcaggacatgcttttaaatttacaagagggtgtctttgtacttcatttatcatttgactatt |
332 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56437766 |
catcaggtcgggtctccgcattgtgtgggttgaagtctgcaggacatgcttttaaatttacaagagggtgtctttgtacttcatttatcatttgactatt |
56437865 |
T |
 |
| Q |
333 |
gttttttagtgcttcaaagatgtgtctttaggcaaaaccatctgatgtattccttgtttggggtcttcacttttgttttgtggaggagagttatggtgat |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56437866 |
gttttttagtgcttcaaagatgtgtctttaggcaaaaccatctgatgtattccttgtttggggtcttcacttttgttttgtggaggagagttatggtgat |
56437965 |
T |
 |
| Q |
433 |
tagctttctgctgtattttacagcttggttgttttttgttcttctt |
478 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
56437966 |
tagctttctgctgtattttacagcttggttgttttctgttcttctt |
56438011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University