View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7595_low_26 (Length: 265)
Name: NF7595_low_26
Description: NF7595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7595_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 23 - 192
Target Start/End: Complemental strand, 37749015 - 37748845
Alignment:
| Q |
23 |
gtatattgtcacataaataaattattattgataaaggagagaagaggtagtgctgatggcactagcactacaagttggcgacaattttttaattaatagt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
37749015 |
gtatattgtcacataaataaattattattgataaaggagaaaggaggtagtgcggatggcactagctctacaagttggtgacaattttttaattaatagt |
37748916 |
T |
 |
| Q |
123 |
tctggtttttcatttaaaaaatcataaccttaaa-tggatccaaatctcatatattccaccataatgtaat |
192 |
Q |
| |
|
||| |||||||||||||||| |||||||| ||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
37748915 |
tcttgtttttcatttaaaaattcataacccaaaagtttatccaaatctcatatattccaccataatgtaat |
37748845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 37748423 - 37748375
Alignment:
| Q |
202 |
tcaaccttttatgttcagcgtacgttttatagtttccgtgcatatttga |
250 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37748423 |
tcaactttttatgttcagcgtacgttttatagtttccgtgcatatttga |
37748375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University