View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7595_low_35 (Length: 238)
Name: NF7595_low_35
Description: NF7595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7595_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 2650525 - 2650747
Alignment:
| Q |
1 |
tcattgtttatttgctttgctggctaataataacggtaacaactttacnnnnnnnagggtagagtgtgacaatcttttgagttgtatagggaccattcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2650525 |
tcattgtttatttgctttgctggctaataataacggtaacaactttactttttttagggtagagtgtgacaatcttttgagttgtatagggaccattcta |
2650624 |
T |
|
| Q |
101 |
gaattaaaaacatgacaccaattgaaggttaagatattcaattaataaataatgttgaggttggtggatgattctggaaacgactagtagatgttgatgg |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2650625 |
gaattaaaaacatgtcaccaattgaaggttaagatattcaattaataaataatgttgaggt----ggatgattctggaaacgactagtagatgttgatgg |
2650720 |
T |
|
| Q |
201 |
gttctgtt----tggtatcttttatgt |
223 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
2650721 |
gttctgtttgtttggtatcttttatgt |
2650747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University