View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7595_low_40 (Length: 207)

Name: NF7595_low_40
Description: NF7595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7595_low_40
NF7595_low_40
[»] chr2 (1 HSPs)
chr2 (18-189)||(41943322-41943493)


Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 41943493 - 41943322
Alignment:
18 atggaagtataatgcatatttctctgggtttttaatgtcatgtttctctctttctatcgttttgtaataatactaccaaaaacttattagtaatcttgag 117  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41943493 atggaagcataatgcatatttctctgggtttttaatgtcatgtttctctctttctatcgttttgtaataatactaccaaaaacttattagtaatcttgag 41943394  T
118 ttacattatgcaacataaactttatgccatagcaatactaaacatttattctcataaaaattatgtagatcc 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41943393 ttacattatgcaacataaactttatgccatagcaatactaaacatttattctcataaaaattatgtagatcc 41943322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University