View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7597_low_12 (Length: 221)
Name: NF7597_low_12
Description: NF7597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7597_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 16 - 205
Target Start/End: Original strand, 15279746 - 15279935
Alignment:
| Q |
16 |
aagaaacta-gaagatgaagaaaagaaaaacttattggagctacaccagcgcggtagtaatggtggccggaatgaaacgatttctaatgttttcannnnn |
114 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
15279746 |
aagaaactaagaagatgaagaaaagaaaaacctattggagctacaccagcgcggtagtaatggtggccagaacgaaacgatttctaatgttttcattttt |
15279845 |
T |
 |
| Q |
115 |
nnncaaatacttggaaggatctcaaaattcattatcaaataatgagttatttagttaataaggaaaaatttgccattactatagttgttat |
205 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15279846 |
tt-caaatacttggaaggatctcaaaactcattatcaaataatgagttatttagttaataaggaaaaatttgccattactatagttgttat |
15279935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University