View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7597_low_3 (Length: 578)
Name: NF7597_low_3
Description: NF7597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7597_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 5e-42; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 315 - 425
Target Start/End: Complemental strand, 38876595 - 38876486
Alignment:
| Q |
315 |
ttattgattaaacttgacattttgattgaataa--tgacttatacaatagtccgggtcccactccaaaagatcagaccaaatatcatcaattcagctgtt |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38876595 |
ttattgattaaacttgacattttgattgaataaaatgacttatacaatagtccgggtcccactccaaaagatcagaccaaat---atcaattcagctgtt |
38876499 |
T |
|
| Q |
413 |
tctccttagttcc |
425 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38876498 |
tctccttagttcc |
38876486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 36 - 131
Target Start/End: Complemental strand, 38876738 - 38876643
Alignment:
| Q |
36 |
ggttcgaatgttgagttaaattgtttgtaaaaatgaatttataatgcaaggatgacactattcatactgtaattgctgtttatgtcgcatcatcac |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38876738 |
ggttcgaatgttgagttaaattgtttgtaaaaatgaatttataatgcaaggatgacactattcatgctgtaattactgtttatgtcgcatcatcac |
38876643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 484 - 540
Target Start/End: Complemental strand, 38876453 - 38876397
Alignment:
| Q |
484 |
tcaaatgttgttctcaagcttccaaatttatcacataacactgtctctgtctctgtc |
540 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38876453 |
tcaaatgttgttctcaagcttccaaatttatcacataacactgtctctgtctctgtc |
38876397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 209
Target Start/End: Complemental strand, 38876628 - 38876592
Alignment:
| Q |
173 |
aatattataatcacgctaataactctctttcaattat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38876628 |
aatattataatcacgctaataactctctttcaattat |
38876592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University