View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7599_1D_high_11 (Length: 203)
Name: NF7599_1D_high_11
Description: NF7599_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7599_1D_high_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 6111153 - 6111322
Alignment:
| Q |
1 |
tcagatgatagggaggaaaggaaaaccatacctgaagtgactcagcatcagtagtcatcaagttggttatttttccagatgcaaattgttttcgcgcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111153 |
tcagatgatagggaggaaaggaaaaccatacctgaagtgactcagcatcagtagtcatcaagttggttatttttccagatgcaaattgttttcgcgcttc |
6111252 |
T |
 |
| Q |
101 |
gtgagtaagccttagagacttgcgaaatactgctgctacctacaaggaaggaaaatggaacaccaaactc |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111253 |
gtgagtaagccttagagacttgcgaaatactgctgctacctacaaggaaggaaaatggaacaccaaactc |
6111322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 203
Target Start/End: Complemental strand, 932727 - 932690
Alignment:
| Q |
166 |
aactcgagaccgtatttctatagtcttttgaatgatgt |
203 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
932727 |
aactcgagactgtatttctataatcttttgaatgatgt |
932690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University