View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7599_1D_low_24 (Length: 216)
Name: NF7599_1D_low_24
Description: NF7599_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7599_1D_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 17881552 - 17881512
Alignment:
| Q |
14 |
aaaatttaactccccaaaatcatgaagagaagagacaattt |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17881552 |
aaaatttaactccccaaaatcatgaagagaagagacaattt |
17881512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 200
Target Start/End: Complemental strand, 17881387 - 17881345
Alignment:
| Q |
158 |
ctatttatgagatctttcacgagtaaaatctttcaattttgat |
200 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
17881387 |
ctatttatgagatcttataggagtaaaatctttcaattttgat |
17881345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University