View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7599_1D_low_5 (Length: 402)
Name: NF7599_1D_low_5
Description: NF7599_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7599_1D_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 66 - 391
Target Start/End: Complemental strand, 33808163 - 33807838
Alignment:
| Q |
66 |
gtgaaaggaaataacatagaagcaacagtggcggccatctttgaacatcagtgggcattgagtgcataaatatacgtgtctcttaaagtaacaatttggt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33808163 |
gtgaaaggaaataacatagaagcaacagtggcggccatctttgaacatcagtgggcattgagtgcataaatatacgtgtctcttaaagtaacaatttggt |
33808064 |
T |
|
| Q |
166 |
tgatatccgttttgacgcgttttgcagaaaaatcaatcaaggcaagaggctgttagctacaagtcctcaaattcatgataagggtagcttgggtaagcat |
265 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33808063 |
tgatatctgttttgacgtgttttgcagaaaaatcaatcaaggcaagaggctgttagctacaagtcctcaaattcatgataagggtagcttgggtaagcat |
33807964 |
T |
|
| Q |
266 |
cacactatttcaaagctgttttgttaaaccttgaatgatatgctttataacccttttgtatctttgtgtgtgtgcatcttgtccccgtgtcctatatttt |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33807963 |
cacactatttcaaagctgttttgttaaaccttgaatgatatgctttataacccttttgtatctttgtgtgtgtgcatcttgtccccgtgtcctatatttt |
33807864 |
T |
|
| Q |
366 |
agacattgcatttgtgatgtccatct |
391 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
33807863 |
agacattgcatttgttgtgtccatct |
33807838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University