View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7600_low_2 (Length: 324)
Name: NF7600_low_2
Description: NF7600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7600_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 260
Target Start/End: Complemental strand, 30370728 - 30370480
Alignment:
| Q |
16 |
catttcacgtttactctctctcagaacctctgcatggatagagannnnnnntgttaatagaaaaatggttgttttaat-----aaaattgaatgacagtg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
30370728 |
catttcacgtttactctctctcagaacctctgcatggatagagagggggggtgttaatagaaaaatggttgttttaatcaagcaaaattgaatgacggtg |
30370629 |
T |
 |
| Q |
111 |
gaaggaacagaacagaagaagaaagacaaaacatgagaaagtgagtgatcgaatggaatgataaagaaggaaccttttggcttaggtttcttggagaaga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30370628 |
gaaggaacagaacagaagaagaaagacaaaacatgagaaagtgagtgatcgaatg-aatgataaagaatgaaccttttggcttaggtttcttggagaaga |
30370530 |
T |
 |
| Q |
211 |
tattgagattcttcatcatcgtatttcttgtctccaaattcttcacacac |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30370529 |
tattgagattcttcatcatcgtatttcttgtctccaaattcttcacacac |
30370480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University