View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7601_low_5 (Length: 229)
Name: NF7601_low_5
Description: NF7601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7601_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 55102684 - 55102896
Alignment:
| Q |
19 |
atagtgagtcataacaatgtttatataaaagtgataattaacacagttaatagaaaacattgatgtgtgcctaataact---------taatagaaaata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
55102684 |
atagtgagtcataacaatgtttatataaaagtggtaattaacacagttaatagaaaacattgatgtgtgcctaataactgaacacagttaatagaaaata |
55102783 |
T |
 |
| Q |
110 |
ttgtgatttcccttcaaatatcattggtgctcaataactgaacacaacaaatcgtaaatcatatctaatctatattttttcgttgattttctcactgtgt |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55102784 |
ttgtgatttcccttcaaacatcattggtgctcaataactgaacacaacaaatcgtaaatcatatctaatctatattttttcattgattttctcactgtgt |
55102883 |
T |
 |
| Q |
210 |
cacacaggttctg |
222 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
55102884 |
cacacagattctg |
55102896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University