View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7602_high_7 (Length: 240)
Name: NF7602_high_7
Description: NF7602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7602_high_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 24 - 240
Target Start/End: Complemental strand, 52773244 - 52773028
Alignment:
| Q |
24 |
acagagcttcaactaaaagacaaaaaagaagaagccacgtgtgatgtttgattggtccgcatgtctctttctgatggaagtactgcaggcaataaaatct |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52773244 |
acagagcttcaactaaaagacaaaaaagaagaagccacgtgtgatgtttgattggtccgcatgtctctttctgatggaagtactgcaggcaataaaatcg |
52773145 |
T |
 |
| Q |
124 |
tatctttgtctctttctgatctgatgagttcgatcgccgtgcctcctgttcatacaactttcgtgtatatcaatcattttttgttccgaaattgttgcat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52773144 |
tatctttgtctctttctgatctgatgagttcgatcgccgtgcctcctgttcatacaactttcgtgtatatcaatcattttttgttccgaaattgttgcat |
52773045 |
T |
 |
| Q |
224 |
tgcattcatgttctgtt |
240 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52773044 |
tgcattcatgttctgtt |
52773028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University