View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7602_low_11 (Length: 206)
Name: NF7602_low_11
Description: NF7602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7602_low_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-106
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 44103096 - 44102891
Alignment:
| Q |
1 |
tgctgacatactaatttgtatatggtgaaccagaacttgaggagcgtcaaaggttcattcgtgtctatctcagttctgaaggttagttagtccattatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44103096 |
tgctgacatactaatttgtatatggtgaaccagaactcgaggagcgtcaaaggttcattcgtgtctatctcagttctgaaggttagttagtccattatga |
44102997 |
T |
 |
| Q |
101 |
atttcactcgtcgaaatcatagattgaaacgcaacacttctgaatatcacatattcctcaaatttaaggttatattacaatcactctttttacacaggca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44102996 |
atttcactcgtcgaaatcatagattgaaatgcaacacttctgaatatcgcatattcctcaaatttaaggttatattacaatcactctttttacacaggca |
44102897 |
T |
 |
| Q |
201 |
agaaac |
206 |
Q |
| |
|
|||||| |
|
|
| T |
44102896 |
agaaac |
44102891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University