View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7602_low_7 (Length: 269)
Name: NF7602_low_7
Description: NF7602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7602_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 4115283 - 4115044
Alignment:
| Q |
1 |
accttacttatatgatgttcatgttcatttatatctaacatgaaagtcatttactcacacttgacaggtcaacggcaacgacacaccatcaactatgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
4115283 |
accttacttatatgatgttcatgttcgtttatatctaacatgaaagttatttactcacacttgacacatcaacggcaatgacacaccaccaactatgttc |
4115184 |
T |
|
| Q |
101 |
aatcttaaatctaatcttaaacttaaaatttggtcatatccgattttttatgagtctcaagttgcctgattgcaaggattcctgctaaaattttgctcga |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4115183 |
aatcttaaa------------cttaaaatttggtcatatccgattttttatgagtctcaagttgcctgattgcaaggattcctgctaaaattttgctcga |
4115096 |
T |
|
| Q |
201 |
tctttgcaattttatccaaaatgtgtaaagcatcattagacgtgtgctctct |
252 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4115095 |
ttattgcaattttatccaaaatgtctaaagcatcattagacgtgtgctctct |
4115044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University