View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7602_low_9 (Length: 243)
Name: NF7602_low_9
Description: NF7602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7602_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 10 - 226
Target Start/End: Original strand, 40013180 - 40013396
Alignment:
| Q |
10 |
aagaatatactaggtaactcccatggattatacttatagagatcaatttcagctataatcgacgctggaagtggacgcgatttgattttgttttgcaagt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40013180 |
aagaacatactaggtaactcccatggattatacttatagagatcaatttcagctataatcgacgctggaagtggacgcgatttgattttgttttgcaagt |
40013279 |
T |
 |
| Q |
110 |
aatgaactatgagttcttcatcagaaggatggaatctgaaaccaggtggaaaagtgtaatttgattttgatccattttgttgtccctccatcaaggaatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40013280 |
aatgaactatgagttcttcatcagaaggatggaatctgaaaccaggtggaaaagtgtaatttgattttgatccattttgttgtccctccatcaaggaatt |
40013379 |
T |
 |
| Q |
210 |
ttatgtatgctttgttt |
226 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40013380 |
ttatgtatgctttgttt |
40013396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University