View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7603_low_9 (Length: 257)
Name: NF7603_low_9
Description: NF7603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7603_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 249
Target Start/End: Complemental strand, 34044839 - 34044601
Alignment:
| Q |
12 |
catcatcag-caactcctccgcctgcaccaacacctgcacccgcgccttcccctttcccatgtcctgtactcgcttgatcaacccagtccactcttcgtc |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34044839 |
catcatcaggcaactcctccgcctgcaccaacacctgcacccgcgccttcccctttctcatgtcctgtacttgcttgatcaacccagtccactcttcgtc |
34044740 |
T |
|
| Q |
111 |
ttcatcttctttggatgttccagcttctttaatttcctcttggggtactgccacaactttacttgtagtggagcgagttcctggttcagtgctctcaatc |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34044739 |
ttcattttctttggatgttccagcttctttaatttcctcttggggtactgccgcaactttacttgtagtggagcgagttcctggttcagtgctctcaatc |
34044640 |
T |
|
| Q |
211 |
tggatgttcaatctattgcaaagatcaaccatattcttc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34044639 |
tggatgttcaatctattgcaaagatcaaccattttcttc |
34044601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 4044761 - 4044991
Alignment:
| Q |
19 |
agcaactcctccgcctgcaccaacacctgcacccgcgccttcccctttcccatgtcctgtactcgcttgatcaacccagtccactcttcgtcttcatctt |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4044761 |
agcaactcctccgcttgcaccaacacctgcacccgagccttcctctttcccatgtcctgtacttgcttgatcaacccagtccactcttcgtcttcatctt |
4044860 |
T |
|
| Q |
119 |
ctttggatgttccagcttctttaatttcctcttggggtactgccacaactttacttgtagtggagcgagttcctggttcagtgctctcaatctggatgtt |
218 |
Q |
| |
|
||| |||||||||||||||||| |||||||||| || |||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4044861 |
cttcggatgttccagcttctttgatttcctcttcagggactgccgtaactttacttgaggtggagcgagttcctgattcagtgctctcaatctggatgtt |
4044960 |
T |
|
| Q |
219 |
caatctattgcaaagatcaaccatattcttc |
249 |
Q |
| |
|
|||||| ||||||||||||||||| |||||| |
|
|
| T |
4044961 |
caatctgttgcaaagatcaaccattttcttc |
4044991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University