View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7606_low_7 (Length: 290)
Name: NF7606_low_7
Description: NF7606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7606_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 43 - 278
Target Start/End: Original strand, 41922899 - 41923148
Alignment:
| Q |
43 |
atctagcaaattgtatgatcgtaaaactattagatatacaagaaaatgagtgtaaaagag--------------agagagatgtctcatttcagagagaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||| |
|
|
| T |
41922899 |
atctagcaaattgtatgatcgtaaaactattagatatacaagaaaatgagtgtgagagagagagagagagagagagagagatgtctcatttcagagagaa |
41922998 |
T |
 |
| Q |
129 |
caagttgaagaatgacagggatggagacggggaggattaagagtagagattacaatggatattcacgggaagcaaagtattcatcggctactcacttatg |
228 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41922999 |
caagttgaaaaatgacagggatggagacggggagaattaagagtagagattacaatggatattcacgggaagcaaagtattcatcggctactcacttatg |
41923098 |
T |
 |
| Q |
229 |
aaataaaattgatattattgtcaacttcgtattagtctttgttgatgtcc |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41923099 |
aaataaaattgatattattgtcaacttcgtattagtccttgttgatgtcc |
41923148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University