View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_high_18 (Length: 475)
Name: NF7607_high_18
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 321 - 457
Target Start/End: Original strand, 7241671 - 7241807
Alignment:
| Q |
321 |
cattgtaagaaaacacctgcggatgcgtcttctgggttgtcacctatgccaatttcatttgatatttcgatgaccgtagaattttcagcctcaaaaaggg |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
7241671 |
cattgtaagaaaacacctgcggatgcgtcttctgggttgtcacctatgccaatttcatttgatattccgatgaccgtagaattttcaacctcaaaaaggg |
7241770 |
T |
 |
| Q |
421 |
gtggagggttttatgattttgaagatgatgggatatc |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7241771 |
gtggagggttttatgattttgaagatgatgggatatc |
7241807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 21027890 - 21027808
Alignment:
| Q |
358 |
tgtcacctatgccaatttcatttgatatttcgatgaccgtagaattttcagcctcaaaaaggggtggagggttttatgatttt |
440 |
Q |
| |
|
|||||||||||||| |||| |||| || ||||||||| ||||||||| |||||||| |||||| |||| || |||||||| |
|
|
| T |
21027890 |
tgtcacctatgccagtttcgtttgcatttccgatgaccggagaattttcggcctcaaataggggtagaggattaaatgatttt |
21027808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University