View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_high_34 (Length: 410)
Name: NF7607_high_34
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 402
Target Start/End: Complemental strand, 19243900 - 19243499
Alignment:
| Q |
1 |
tttgatagtttcttttttaataactagcactcaatctatgttttttcttaaggttttaaactgtggatgctctttctgaaaaatcatgccttactaatct |
100 |
Q |
| |
|
|||||||||||||||| ||| | | ||||| | ||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||| |
|
|
| T |
19243900 |
tttgatagtttcttttgtaaaaccaagcacacgatcaatgttttttcttaaggttttaaactgtcgatgcactttctgaaaaatcatgccttaataatct |
19243801 |
T |
 |
| Q |
101 |
tagtatatgatcaatttaacatgaaactgttgtgattagcttcagtttatagtgaaaacaggatctatcttattgtcatattaccaaaagtttaagaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19243800 |
tagtatatgatcaatttaacatggaactgttgtgattagcttcagtttatagtgaaaacaggatctattttattgtcatattaccaaaagtttaagaaaa |
19243701 |
T |
 |
| Q |
201 |
tttatcactcttgcttttatagtttttgttttatcatttgattgcaaaagtttaccaccttaagttaaatgcgtcaaacctgaaatctagttctgatgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19243700 |
tttatcactcttgcttttatagtttttgttttatcatttgattgcaaaagtttaccaccttaagttaaatgcgtcaaacctgaaatctagttctgatgat |
19243601 |
T |
 |
| Q |
301 |
gtgattaaaatttcaggcaatccattgatctgtatggtagcgtgccatcgccgaatataggatttcttggaacgacgtcattggcaagattaggcagttc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19243600 |
gtgattaaaatttcaggcaatccattgatctgtatggtagcgtgccatcgccgaatataggatttcttggaacgacgtcattggcaagattaggcagttc |
19243501 |
T |
 |
| Q |
401 |
tt |
402 |
Q |
| |
|
|| |
|
|
| T |
19243500 |
tt |
19243499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University