View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_high_61 (Length: 298)
Name: NF7607_high_61
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_high_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 73 - 284
Target Start/End: Complemental strand, 47862223 - 47862012
Alignment:
| Q |
73 |
taaatgtatgatactgtaatttattagctgaattccctgaaatttaaatgtaagtctacaggtatttcaatttgatagggttgtgaaggaaaccctatgg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47862223 |
taaatgtatgatactgtaatttattagctgaattccctgaaatttaaatgtaagtctacaggtatttcaatttgatagggttgtgaacgaaaccctatgg |
47862124 |
T |
|
| Q |
173 |
agaaaaagtgaatgagatacaagccatggcatgtatttgaagtcccacttgcatccatatatcacaggaggagtaggtgttattaatcagtttactcaaa |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
47862123 |
agaaaaagtgaatgagatacaagccatggcatgtatttgaagtcccacttgcatccatatatcacaggaggaataggtgttattaatcagttcactcaaa |
47862024 |
T |
|
| Q |
273 |
taagttgttgat |
284 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47862023 |
taagttgttgat |
47862012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University