View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_high_62 (Length: 297)
Name: NF7607_high_62
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 291
Target Start/End: Original strand, 8445198 - 8445469
Alignment:
| Q |
18 |
ctatctgtacttgacacgtcccaaactcaattctatcatctctaataatactatcataaacataaacattactttcatatctaaatattattcattcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8445198 |
ctatctgtacttgacacgtcccaaactcaattctatcatctctaataatactctcataaacataaacattactttcatatctaaatattattcattcatt |
8445297 |
T |
 |
| Q |
118 |
cttctcttatattacacaaaccaatctctttttatctctctgcccattggcgtttctttcagcacttggagagggggatctgtggattcaacaattcctc |
217 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8445298 |
cttctcttat--tacacaaaccaatctctttttatctctctgcccattggcgtttctttcagcacttggagagggggatctgtggattcaacaattcctc |
8445395 |
T |
 |
| Q |
218 |
tatttcttgctaaatgtctttgtttttaccctcaagtcttcaacgaggatgggaaacaatgaattacctttgct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
8445396 |
tatttcttgctaaatgtctttgtttttaccctcaagtcttcaacgaggatcggaaacaatgaattatctttgct |
8445469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University