View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_high_75 (Length: 251)
Name: NF7607_high_75
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_high_75 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 35507878 - 35507643
Alignment:
| Q |
16 |
ataaataaggatgaagctaataactagaaactagaaagtgagataaagagtatggttgatgggtccaatgcaaatagtggaccatagtaaagcttctata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35507878 |
ataaataaggatgaagctaataactagaaactagaaagtgagataaagagtatggttgatgggtccaatgcaaatagtggaccatagtaaagcttctata |
35507779 |
T |
 |
| Q |
116 |
aattatcaaatgtttgtggtctgcaagtcagcagtatctttcttgggagcatcaattttgtatgggcttcgaacttccactaatagatgatcccaaagct |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35507778 |
aataatcaaatgtttgtggtctgcaagtcagcagtatctttcttgggagcatcaattttgtatgggcttcgaacttccactaatagatgatcccaaagct |
35507679 |
T |
 |
| Q |
216 |
acacatatgatgcaataaatcaaatttaacaactaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35507678 |
acacatatgatgcaataaatcaaatttgacaactaa |
35507643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 183
Target Start/End: Original strand, 20923880 - 20923914
Alignment:
| Q |
149 |
gtatctttcttgggagcatcaattttgtatgggct |
183 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
20923880 |
gtatctttcttgggagcatcaactttgtatgggct |
20923914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University