View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_high_78 (Length: 250)
Name: NF7607_high_78
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_high_78 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 173 - 250
Target Start/End: Original strand, 42732164 - 42732241
Alignment:
| Q |
173 |
tggcatgacactaaaaattagatgataagtacgtatcaacaaagcttcagacgacataagactcacctttattattta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42732164 |
tggcatgacactaaaaattagatgataagtacgtatcaacaaagcttcagacgatataagactcacctttattattta |
42732241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 47
Target Start/End: Original strand, 42732062 - 42732096
Alignment:
| Q |
13 |
aatatatatcttaaccctcatgttttgaagtcaat |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42732062 |
aatatatatcttaaccctcatgttttgaagtcaat |
42732096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University