View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_high_85 (Length: 240)
Name: NF7607_high_85
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_high_85 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 42471751 - 42471970
Alignment:
| Q |
1 |
ctcatttacgacaaatatacgttacattaacattgtaaataaatttgagccagttatttgagtagtcatgatcaccttta-agacacttgatggactagt |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
42471751 |
ctcatttacgacaaatatacgctacattaacattgtaactaaatttgagccagttatttgcgtagtcatgatcaccttaagacacacttgatggactagt |
42471850 |
T |
 |
| Q |
100 |
tagtatcaacaaacagtttatcaatccatgaacacgcgtaactgttggtggcgtgctcttcacctccaagcttctatcaaacttcacatgtaatttggtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471851 |
tagtatcaacaaacagtttatcaatccatgaacacgcgtaactgttggtggcgtgctcttcacctccaagcttctatcaaacttcacatgtaatttggtt |
42471950 |
T |
 |
| Q |
200 |
gacataaactgtttggaacc |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42471951 |
gacataaactgtttggaacc |
42471970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University