View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_high_87 (Length: 238)
Name: NF7607_high_87
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_high_87 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 49013326 - 49013105
Alignment:
| Q |
17 |
gaaattagcattgtctagctagttgagcttgattatatctctcaatcagacacgttgatgtgcaatttataattatagagcaaaagtaatatgatatggt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49013326 |
gaaattagcattgtctagctagttgagcttgattatatctctcaatcagacacgttgatgtgcaatttataattacagagcaaaagtaatatgatatggt |
49013227 |
T |
 |
| Q |
117 |
tgtccttgcttgctggcttaaggaaaataatctcatatggggaaatggtaaaccttacgaaatagtcaaaccactaaacacaccaaggctattcttatcg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
49013226 |
tgtccttgcttgctggcttaaggaaaataatctcatatgggaaaatggtaaaccttacgaaatagtcaaaccactaaatacaccaaggctattcttctcg |
49013127 |
T |
 |
| Q |
217 |
agttgagatcttctccatttcc |
238 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
49013126 |
aggtgagatcttctccatttcc |
49013105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University