View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_high_90 (Length: 236)
Name: NF7607_high_90
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_high_90 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 236
Target Start/End: Original strand, 33007601 - 33007817
Alignment:
| Q |
17 |
aaagtttgcaaaaaacatcattgaagaagataaatggagatttctaatataaagtgaagttacctacacccttgtgtgacataatatgatgttggataca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33007601 |
aaagtttgcaaaaaacatcattgaagaagataaatggagatttctaacataaagtgaagttgcctacacctttgtgtgacataatatgatgttggataca |
33007700 |
T |
|
| Q |
117 |
attttgtgccgccacgtaagcagttaaaaggtcacgacatattcctaaacggatagaagtaataatagaaggtggacattgcctgactgcaaacaatgcc |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33007701 |
attttgcgccgccacgtaagcagttaaaaggtcacgacatattcgtaaacggatagaag---taatagaaggtggacattgcctgactgcaaacaatgcc |
33007797 |
T |
|
| Q |
217 |
ctaaggtattttgcaaattt |
236 |
Q |
| |
|
| |||| ||||||||||||| |
|
|
| T |
33007798 |
caaaggcattttgcaaattt |
33007817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University