View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_101 (Length: 224)
Name: NF7607_low_101
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_101 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 1951067 - 1951267
Alignment:
| Q |
1 |
gcacgtagtctttgacaaacggtcaaaagaaccttgagcttgaatacaaactcaacatacggatagctctgactagaaccaacttccaataactacaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951067 |
gcacgtagtctttgacaaacggtcaaaagaaccttgagcttgaatacaaactcaacatacggatagctctgactagaaccaacttccaataactacaatg |
1951166 |
T |
 |
| Q |
101 |
cttcagatgcatctcattcaacgatgaactatttcattttccctaaaatattttatgaatgttttcttcaatttatgtgtaaaaaaatatattaaacgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1951167 |
cttcagatgcatctcattcaacgatgaactatttcattttccctaaaatattttatgaatgttttcttcaatttatgtgtaaaaaaa-atattaaacgaa |
1951265 |
T |
 |
| Q |
201 |
gc |
202 |
Q |
| |
|
|| |
|
|
| T |
1951266 |
gc |
1951267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University