View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7607_low_102 (Length: 221)

Name: NF7607_low_102
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7607_low_102
NF7607_low_102
[»] chr3 (1 HSPs)
chr3 (10-67)||(44186647-44186704)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 10 - 67
Target Start/End: Original strand, 44186647 - 44186704
Alignment:
10 ccaagaaaatcattctctcgacttcatcatagaattttcctactttactatgtgtcaa 67  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||    
44186647 ccaaaaaaatcattctctcgacttcatcatagaattttcctactttactatgtttcaa 44186704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University