View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_102 (Length: 221)
Name: NF7607_low_102
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_102 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 10 - 67
Target Start/End: Original strand, 44186647 - 44186704
Alignment:
| Q |
10 |
ccaagaaaatcattctctcgacttcatcatagaattttcctactttactatgtgtcaa |
67 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44186647 |
ccaaaaaaatcattctctcgacttcatcatagaattttcctactttactatgtttcaa |
44186704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University