View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_107 (Length: 210)
Name: NF7607_low_107
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_107 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 11 - 196
Target Start/End: Complemental strand, 18025212 - 18025022
Alignment:
| Q |
11 |
aagaaaattatgacatctgtggaaaaaa-tataattgattctcttttttgtaattaaataatgcaccaggaccaccaaaatcatatacaaaaggaacaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
18025212 |
aagaaaattatgacatctgtggaaaaaaatataattgattatcttttttgtaattaaataatgcaccaggaccacaaaaatcatatacaaaacgaacaag |
18025113 |
T |
|
| Q |
110 |
tgtagttctaattggttgcttccatagacgttcctaagtacat-ggtaacaaagtaacaac---aatcacgaaatgttcacatgttaaata |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18025112 |
tgtagttctaattggttgcttccatagacgttcctaagtacatgggtaacaaagtaacaacaataatcacgaaatgttcacatgttaaata |
18025022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University