View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_71 (Length: 287)
Name: NF7607_low_71
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_71 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 274
Target Start/End: Complemental strand, 29913222 - 29912953
Alignment:
| Q |
13 |
aaaatcttgattaggataatgttttgttgttgacaacatgaggacatttgttaaactcgataagagccacatgctaattgtcttttagaggattctaaat |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29913222 |
aaaaccttgattaggataatgttttgttgttgacaacatgaggacatttgttaaactcgataagagccacatgctaattgtcttttagaggattctaaat |
29913123 |
T |
|
| Q |
113 |
ttcttagat-cccatgtgatttgtaacgtg-aaattttaccaaacaaaagaaatatttagcaaacagtttatatagatgcttaaaataacacggtttatc |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
29913122 |
ttcttagatccccatgtgatttgtaacgtgaaaattttaccaaacaaaagaaatattttataaacagcttatatagatacttaaaataacacggcttatc |
29913023 |
T |
|
| Q |
211 |
ctaat------gcttaaaataataaaaattccaaaataaggagagtgaagtaattaattcaaaggaacta |
274 |
Q |
| |
|
||| | |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29913022 |
ctattattttaacttaaaataacaaaaattccaaaataaggagagtgaagtaattaattcaaaggaacta |
29912953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University