View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_75 (Length: 273)
Name: NF7607_low_75
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_75 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 12648444 - 12648583
Alignment:
| Q |
19 |
aaaggttgggttatgagcttatctacactaggcaagttggcaaaagagaaggtagtgactaagatgtgcataaattcactcactactttctccgtccaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12648444 |
aaaggttgggttatgagcttatctacactaggcaagttggcaaaagagaaggtagtgactaagatgtgcataaattcactcactactttctccgtccaat |
12648543 |
T |
|
| Q |
119 |
aatgttttcctacatggctgccaccatgaagttaatgtag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12648544 |
aatgttttcctacatggctgccaccatgaagttaatgtag |
12648583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 194 - 255
Target Start/End: Original strand, 12648619 - 12648680
Alignment:
| Q |
194 |
gatgtgtgattattctatttttatcaataaaccacttttagatggtcaaataatggaaataa |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12648619 |
gatgtgtgattattctatttttatcaataaaccacttttagatggtcaaataatggaaataa |
12648680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University