View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_81 (Length: 251)
Name: NF7607_low_81
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_81 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 12648341 - 12648104
Alignment:
| Q |
1 |
cttaacttataaaaatatgggaatggaatggaaaatgcatttctagttatgtacattaaattctcactgcacccttcaagattgagagagagtcacaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12648341 |
cttaacttataaaaatatgggaatggaatggaaaatgcatttctagttatgtacattaaatgctcactgcacccttcaagattgagagag--tcacaata |
12648244 |
T |
|
| Q |
101 |
tctagtttttctttatctacaagggatagtggtcccacttatttaaattgcttagtccatgatgtcattcatatta-nnnnnnnctcataagttaatgtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12648243 |
tctagtttttctttatctacaagggaaagtggtcccacttatttaaattgcttagtccatgatgtcattcatattattttttttctcataagttaatgtt |
12648144 |
T |
|
| Q |
200 |
acatgagacggtaggattaaattgcttaatccctgatatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12648143 |
acatgagacggtaggattaaattgcttaatccgtgatatt |
12648104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University