View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_82 (Length: 250)
Name: NF7607_low_82
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_82 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 47862267 - 47862511
Alignment:
| Q |
1 |
tggtttaatctt-gacgcatattatgaacgttgagtgagatttcattcagttatacaacactaatgttttgtgtaccctattattctgacacattcatgc |
99 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47862267 |
tggtttaatctttgacgcatattatgaacgttgagtgagatttcattcagttatacaacactaatgttttgtgtaccttattattctgacacattcatgc |
47862366 |
T |
|
| Q |
100 |
tagttatttacacgtgtctggttcaagagaaagtgacgcgagagaggtttatgtgagaattggaacacttcttttgttcgtaagatcagtgaaataagga |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47862367 |
tagttgtttacacgtgtctggttcaagagaaagtgacgcgagagaggtttatgtgagaattggaacacttcttttgttcgtaagatcagtgaaataagga |
47862466 |
T |
|
| Q |
200 |
agagaggttgacacgtgtggggcccatggttttttattttcttcg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47862467 |
agagaggttgacacgtgtggggcccatggttttttattttcttcg |
47862511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University