View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7607_low_83 (Length: 250)

Name: NF7607_low_83
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7607_low_83
NF7607_low_83
[»] chr7 (2 HSPs)
chr7 (173-250)||(42732164-42732241)
chr7 (13-47)||(42732062-42732096)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 173 - 250
Target Start/End: Original strand, 42732164 - 42732241
Alignment:
173 tggcatgacactaaaaattagatgataagtacgtatcaacaaagcttcagacgacataagactcacctttattattta 250  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
42732164 tggcatgacactaaaaattagatgataagtacgtatcaacaaagcttcagacgatataagactcacctttattattta 42732241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 13 - 47
Target Start/End: Original strand, 42732062 - 42732096
Alignment:
13 aatatatatcttaaccctcatgttttgaagtcaat 47  Q
    |||||||||||||||||||||||||||||||||||    
42732062 aatatatatcttaaccctcatgttttgaagtcaat 42732096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University