View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_88 (Length: 247)
Name: NF7607_low_88
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_88 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 43439851 - 43440081
Alignment:
| Q |
1 |
cttggctatgtaactcataaatgtacattctcnnnnnnngcatgcatagtgtggctttattttgctttaagctattttacatcattatattaattctgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439851 |
cttggctatgtaactcataaatgtacattctctttttttgcatgcatagtgtggctttattttactttaagctattttacatcattatattaattctgtg |
43439950 |
T |
 |
| Q |
101 |
agtgttatcaagtttgttatttggtatcaagtatcaacatatatatcgtgactctttataatatgagcatgtcggagattcatgtatatatcaacccaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439951 |
agtgttatcaagtttgttatttggtatcaagtatcaacatatatattgtgactctttataatatgagcatgtcggagattcatgtatatatcaacccaat |
43440050 |
T |
 |
| Q |
201 |
tggaaataggctttaacaaagaccaagagag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43440051 |
tggaaataggctttaacaaagaccaagagag |
43440081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University