View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_90 (Length: 241)
Name: NF7607_low_90
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_90 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 41704415 - 41704640
Alignment:
| Q |
1 |
gttgaaacattttgtaaggtttctcccctccagtgcttgatttcagcacaatttctctttccttggcctgcttctccctgtagttagagtgtttgaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704415 |
gttgaaacattttgtaaggtttctcccctccagtgcttgatttcagcacaatttctctttccttggcctgcttctccctgtagttagagtgtttgaagga |
41704514 |
T |
 |
| Q |
101 |
ctttgtgatgatcacaagaatcacagccaatgnnnnnnnngcaataaccactattgagacaaccaagctggttttccatttggattctctcttgtacctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704515 |
ctttgtgatgatcacaagaatcacagccaatgaaaaaaaagcaataaccactattgaaacaaccaagctggttttccatttggattctctcttgtacctt |
41704614 |
T |
 |
| Q |
201 |
acacaggttgctgcaaaagggtccca |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41704615 |
acacaggttgctgcaaaagggtccca |
41704640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 84
Target Start/End: Original strand, 1440620 - 1440672
Alignment:
| Q |
32 |
agtgcttgatttcagcacaatttctctttccttggcctgcttctccctgtagt |
84 |
Q |
| |
|
|||||||| |||||||| |||||||||||| |||| ||||| ||||| ||||| |
|
|
| T |
1440620 |
agtgcttggtttcagcagaatttctctttctttggtctgctactcccggtagt |
1440672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University