View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7607_low_92 (Length: 238)
Name: NF7607_low_92
Description: NF7607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7607_low_92 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46676944 - 46676720
Alignment:
| Q |
1 |
tgtaagttctaaagcatgctcctttggttttatgctta----gtgtgtcctttttcagttcaattttgtcaattataattgaattcataagttattgcga |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46676944 |
tgtaagttctaaagcatgctcctttggttttatgcttaattagtgtgtcctttttcagttcaattttgtcaattataattgaattcataagttattgcga |
46676845 |
T |
|
| Q |
97 |
gggacgataatttgggcttaatgactttcagattaaccttcttttctcaattttactgcacggaaccttcttttcgtgtgaagattgcctcaacaaacct |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
46676844 |
gggacaataatttgggcttaatgactttcagattaaccttcttttctcaattttactgcaaggaacct--tgctcgtgtgaagattgcctcaacaaacct |
46676747 |
T |
|
| Q |
197 |
attaatgaagatacagttctgcaaact |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46676746 |
attaatgaagatacagttctgcaaact |
46676720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 191 - 223
Target Start/End: Original strand, 33988398 - 33988430
Alignment:
| Q |
191 |
aaacctattaatgaagatacagttctgcaaact |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33988398 |
aaacctattaatgaagatacagttctgcaaact |
33988430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 46680510 - 46680451
Alignment:
| Q |
1 |
tgtaagttctaaagcatgctcctttggttttatgcttagtgtgtcctttttcagttcaat |
60 |
Q |
| |
|
||||||||||||| || |||||||| ||||||||||||||||| || | |||||||||| |
|
|
| T |
46680510 |
tgtaagttctaaaacacgctcctttatttttatgcttagtgtgttctctctcagttcaat |
46680451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 141
Target Start/End: Complemental strand, 46680421 - 46680387
Alignment:
| Q |
107 |
tttgggcttaatgactttcagattaaccttctttt |
141 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
46680421 |
tttgggcttaatgactgtcagattaaccttctttt |
46680387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 136
Target Start/End: Complemental strand, 46703206 - 46703178
Alignment:
| Q |
108 |
ttgggcttaatgactttcagattaacctt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46703206 |
ttgggcttaatgactttcagattaacctt |
46703178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 223
Target Start/End: Complemental strand, 21727419 - 21727387
Alignment:
| Q |
191 |
aaacctattaatgaagatacagttctgcaaact |
223 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
21727419 |
aaacctattaatgacgatacagttctgcaaact |
21727387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University